recentpopularlog in
« earlier  
(429) https://twitter.com/i/web/status/1228859148030201856
never forget that a political aim of private insurance is to ensure that wealthy people can have excellent healthca…
2 days ago
(429) https://twitter.com/i/web/status/1228855385253175296
yesterday i talked to a guy for twenty minutes and then i asked him what he does for a living and he went “...Antho…
2 days ago
(429) https://twitter.com/i/web/status/1228790607579090945
I’m a little you-know-what (it’s legal in canada yeah!!) but I just want to say that I got three fucking amazing sh…
2 days ago
Twitter
RT : “The Wet'suwet'en are not protestors, and neither are we - we are taking direction from Indigenous Natural Law, whi…
2 days ago
(429) https://twitter.com/i/web/status/1228690428200964097
What a difference a few years makes. Post-Snowden: "Oh haha, you want to block the snoopy NSA? Suuuure, OK, cu…
2 days ago
(429) https://twitter.com/drovics/status/1228468971440984064
They better stop messing with folks land and sovereignty
2 days ago
Twitter
RT : I made an ultrasonic microphone jammer in 2014 while at . My issue was that it was big and bulky but I g…
3 days ago
Twitter
Will they have a special patch on their arms to help us identify them because really
3 days ago
Twitter
On the one hand I support my 3 yr-old niece suddenly becoming very interested in her aunt’s Bernie organizing confe…
3 days ago
Twitter
"yeah idk mom, they keep telling us that we're going to get to the computer stuff but for the la…
3 days ago
Twitter
And giving a shit about other people is radical. We’re working on a project that not only requires re…
3 days ago
Untitled (https://www.youtube.com/watch?v=-43-4LfqiTA)
RT : on our Wearable Microphone Jammer (see it in action here: ). it uses ultrasound to…
3 days ago
Twitter
RT : on our Wearable Microphone Jammer (see it in action here: ). it uses ultrasound to…
3 days ago
Twitter
*starts stockpiling dried wasps nests, iron nails and dead venomous insects in order to ~*~bring the magic~*~*
3 days ago
Twitter
RT : Am trying this thing where I make pretty descriptions of things I really want to understand so I am motivated to un…
3 days ago
Twitter
RT : Here are some candy hearts written by the neural net GPT-2. It's one of the most powerful text-generating neural ne…
3 days ago
Twitter
me when i get to campus and see the dozens of cops brought in by the University of California to suppress the…
3 days ago
Twitter
Because the anarchist polymorph is so attractive and then you hit the “but wait” and I like Sword in The…
3 days ago
Twitter
my personal Arthurian curse is seeking out every depiction of Merlin I can and then remembering, as fo…
3 days ago
Twitter
Walking into a javascript interview but the water bottle is a healthy knowledge of .reduce()
3 days ago
AFAB PAULIE WALNUTS (@DJMEATDADDY) on Twitter
my therapist rightfully identified my jacket as “a lot”
4 days ago
Twitter
Taking a neural net trained to generate human faces and then training it for juuuust a tiny bit on beetles

this is…
4 days ago
Twitter
Schopenhauer on the importance of *not* reading
4 days ago
(429) https://twitter.com/i/web/status/1227782758128181248
It's really heartwarming to see media personalities wear my anti-surveillance fashion stuff. It reinforces what I t…
5 days ago
Twitter
RT : Faculty stand in solidarity with graduate students at the base of campus on the third day of the full teaching stri…
5 days ago
(429) https://twitter.com/i/web/status/1227738748714045441
Such political gaslighting, the idea that progress is achieved through quiet compromise around a large ta…
5 days ago
Twitter
RT : Chant of mass linked arm in arm, facing off with riot police: “Spread the strike!”
UCSCstrike 
5 days ago
(429) https://twitter.com/i/web/status/1227659523982348290
sending this thread back in time to before i decided to put myself 40k in debt that did me very little good & left…
5 days ago
(429) https://twitter.com/lauraehall/status/1227645725732769792/photo/1
The Winter Lights Festival ran in Portland last weekend and the world’s smallest park was dressed for the occasion
5 days ago
Twitter
10/ this tallies with my phenomenological experience: what if the “attention economy” is merely an expression of th…
6 days ago
Twitter
Like, I'm not saying the american experiment was getting good results, or was even begun on a bed of robust, sound,…
6 days ago
Twitter
I know it's fashionable in some corners of this interactive web site to mock a Freudian slip by but I will not…
8 days ago
Twitter
This reminds me of the time my girlfriend asked if an Instagram influencer's explanation of…
8 days ago
Twitter
"crazy lazy French who take long lunches and have 5 weeks mandatory paid vacations and universal healthcare and fre…
8 days ago
Twitter
me: hey I might misspeak or act weird but if you ask me to clarify I can! picking the precise social action to conv…
9 days ago
Twitter
I mean what about this isn't clear?
9 days ago
(503) https://noise.kitchen/
hi! I'd like to order a Kong as soon as I can. Should I check your site later or email someone?
9 days ago
Twitter
it's fun to make a lot of jokes about using neural networks to reinvent phrenology, but also, seriously, it's humil…
9 days ago
Twitter
unbelievably, I've just signed a piece of (metaphorical) paper that says I'm going to get paid to help verify softw…
9 days ago
Twitter
i just took a DNA test and it turns out I'm 100% CTATGAGACCAGTAATAAATATCTTAATATCAAAACCAGACAATGACATTACAAGGAAAGAAAACT…
10 days ago
Twitter
I face the future of the internet with a fundamental optimism. I think we’ve barely scratched what collective power…
12 days ago
« earlier      
per page:    204080120160

Copy this bookmark:





to read